Skip to main content

Advertisement

Table 1 Oligonucleotide primers used for RT-PCR

From: Fetal asphyctic preconditioning modulates the acute cytokine response thereby protecting against perinatal asphyxia in neonatal rats

Primer Tm° Sequence (5’-3’)
HPRT for 64.1 TTGCTGGTGAAAAGGACCTC
HPRT rev 64.0 TCCACTTTCGCTGATGACAC
β-actin for 64.2 TTGCTGACAGGATGCAGAAG
β-actin rev 64.0 TGATCCACATCTGCTGGAAG
GAPDH for 63.4 CTCCCATTCTTCCACCTTTG
GAPDH rev 63.8 ATGTAGGCCATGAGGTCCAC
IL-1β for 67.0 TACCTATGTCTTGCCCGTGGAG
IL-1β rev 67.6 ATCATCCCACGAGTCACAGAGG
TNFα for 64.0 TGCCTCAGCCTCTTCTCATT
TNFα rev 63.2 GGGCTTGTCACTCGAGTTTT
IL-6 for 62.5 AAAGCCAGAGTCATTCAGAGC
IL-6 rev 63.8 GAGCATTGGAAGTTGGGGTA
IL-10 for 64.0 CCTGCTCTTACTGGCTGGAG
IL-10 rev 63.8 TGTCCAGCTGGTCCTTCTTT
IL-1R1 for 63.7 TTGTGTTTAAGCTGTTGCCG
IL-1R1 rev 62.4 GTAACCTCGATGGTATCTTCCC
IL-1R2 for 61.9 AGCACGTTTATCTCAGTGGC
IL-1R2 rev 65.5 GTGACTGGATCAAAAATCAGCG
TNFR1/p55 for 61.9 AGTCTACTGTGCCGATATCCC
TNFR1/p55 rev 64.9 CTTTGACAGGAGCTGAATCCC
TNFR2/p75 for 64.0 AAATGCAAGCACAGATGCAG
TNFR2/p75 rev 64.3 CAGCAGACCCAGAGTTGTCA
IL-6R for 63.8 CTGGTTCCTCTCCTCACCC
IL-6R rev 64.9 TGTTGCTGTTGTCATTAGGGC
IL-10R for 63.8 ATTTCACCGTGACCAACCTC
IL-10R rev 64.1 CCAGGATGTGAATGTCATCG