Skip to main content

Advertisement

Table 1 PCR Primers

From: Microglial activation decreases retention of the protease inhibitor saquinavir: implications for HIV treatment

Gene Forward Primer Reverse Primer
Slc22a1 TCTGGCTACAGGAGAACGACGGCCA TGCTCCATTATCCTGACAGCTCGCGT
Slc22a2 TCGAAACAGAGGAGGATTGTGGGAATA GAGAGGTGTTTCCCATTGCACTTAGCCAC
Slc22a6 TATGTGGGCACCTTGATTGGC AGGGTGAGGTCCAGCCTTCCT
Slc22a8 ATCTCATCAACATCTATTGGG AGGGCCTTTGAGTATTTTCCA
Slco1a1 TATGGAGGACAAGCCAGAGAG AGAGGTGGTTAATCCAGCAAC
Slco1a2 CACAGAAAAAAGGCCAAGGAA TAAGGAAAGACAGAAGGTACT
Slco1a5 CACAGAGAAAAAGCCAAAGAG AGAGGCAGTTAAGCCGGCAAC
  1. Slc22a, solute carrier family 22; Slco, solute carrier organic anion family.