Skip to main content

Advertisement

Table 1 Sequences of primers used for RT-PCR

From: Genetic variability in the rat Aplec C-type lectin gene cluster regulates lymphocyte trafficking and motor neuron survival after traumatic nerve root injury

Primer name Forward sequence Reverse sequence
Gapdh TCAACTACATGGTCTACATGTTCCAG TCCCATTCTCAGCCTTGACTG
Hprt CTCATGGACTGATTATGGACAGGAC GCAGGTCAGCAAAGAACTTATAGCC
Cd11b ATCCGTAAAGTAGTGAGAGAAC TCTGCCTCAGGAATGACATC
Gfap AAGCACGAGGCTAATGACTATCG AAGGACTCGTTCGTGCCG
Mrf-1 GGAGGCCTTCAAGACGAAGTAC AGCATTCGCTTCAAGGACATAATA
Cd4 GCTCCCACTCACCCTTCAGATAC CTTCACCTTCACTCAGTAGACATTGC
Cd8a ACACCAGAGATAGTCCCAGTTTCAG GCCAGCAATTTCCCAGTTCCTTAC
Cd69 ACGCTACCCTTGCTGTTATTGATTC GTCTTCTTCCTTGTGTTCCATAGTCC
Clecsf6/Dcir1 CTGAACCGTGATGCTGCTTA TGCTGTTTACCACTGCAAGG
Clec4a2/Dcir2 CCATCATCCAAGTAAGCCAGGTTC GAGTCAGTTGAAGTAAAGTAGCAGTAGG
Clec4a3/Dcir3 TGCCACAAGTTCTTCAAGG TCCAATTCAGTATAGTTCAGTTCC
Clec4a1/Dcir4 CATTCGTCCGTGGAAGACAAA TGCAGAGTCCCTGGAAGTGAA
Clec4b2/Dcar1 TGCTCATCTGTTGGTGATCCA TGTAAAATAACCCCAACGAGTGTCTA
Clec4e/Mincle TTTCACAGAGTCCCTGAGCTTCT TCCCTCATGGTGGCACAGT
Clec4d/Mcl CACAAGGCTAACATGCATCCTAGA GCAAAGTAACAGTTAGACTGGAATGCT
  1. RT-PCR: real-time polymerase chain reaction.