Skip to main content

Table 1 Primer sets for murine genes

From: CX3CR1 deficiency suppresses activation and neurotoxicity of microglia/macrophage in experimental ischemic stroke

Gene Encoded protein Primer
 GAPDH Glyceraldehyde-3-phosphate dehydrogenase Forward: 5′- TGATGACATCAAGAAGGTGGTGAAG -3′
Reverse 5′- TCCTTGGAGGCCATGTAGGCCAT-3′
M1   
 iNOS Nitric oxide synthase, inducible (iNOS) Forward: 5′-CCCTTCAATGGTTGGTACATGG-3′
Reverse: 5′-ACATTGATCTCCGTGACAGCC-3′
M2   
 Mrc1 Mannose receptor, C type 1 (MRC1), Macrophage mannose receptor 1 (MMR), CD206 Forward: 5′-TCTTTGCCTTTCCCAGTCTCC-3′
Reverse: 5′-TGACACCCAGCGGAATTTC-3′
 Ym1 T-lymphocyte-derived eosinophil chemotactic factor (FCF-L) Forward: 5′-GGGCATACCTTTATCCTGAG-3′
Reverse: 5′-CCACTGAAGTCATCCATGTC-3′