Skip to main content

Table 1 Primer sequences, annealing temperatures, and product sizes for RT-PCRs

From: The in vitro GcMAF effects on endocannabinoid system transcriptionomics, receptor formation, and cell activity of autism-derived macrophages

 Gene   Sense primer (5′-3′)   Antisense primer (5′-3′) Annealing temperature (°C) Product sizes (bp)
CB2R TTGGCAGCGTGACTATGACC AGGAAGGCGATGAACAGGAG 55 274
FAAH GGCCACACCTTCCTACAGAA GTTTTGCGGTACACCTCGAT 58 218
NAPE-PLD GAAGCTGGCTTAAGAGTCAC CCGCATCTATTGGAGGGAGT 60 178
GAPDH TCACCAGGGCTGCTTTTAAC GGACTCCACGACGTACTCAG 55 242
  1. PCR primers were designed by using the computer program OLIGO 4.05 software (National Biosciences Inc., Plymouth, MN, USA) and were purchased from PRIMM (Milan, Italy).