Skip to main content

Table 1 Primer sequences used for qRT-PCR

From: Reduced immune cell infiltration and increased pro-inflammatory mediators in the brain of Type 2 diabetic mouse model infected with West Nile virus

Gene (Accession No.) Primer Sequence (5′-3′) Amplicon
(bp)* Tm (°C)#
CD45 [GenBank: L36091]    
Forward GCCCAAACAAATTACACAT 107 58
Reverse TTAGGCGTTTCTGGAATC   
CD4 [GenBank: NM_013488]    
Forward GGAAGACTCTCAGACTTAT 79 57
Reverse GAAGGTCACTTTGAACAC   
CD8 [GenBank: NM_009857]    
Forward GTAATGAGCAGACTGTAAC 79 56
Reverse CTATATGATGGGCAGACA   
CD11b [GenBank: EF101557]    
Forward GCATGTCAAGAACAAGTA 133 56
Reverse CTAAAGCCAGGTCATAAG   
GFAP [GenBank: NM_010277]    
Forward GTGGATTTGGAGAGAAAG 177 56
Reverse GTATTGAGTGCGAATCTC   
ICAM-1 [GenBank: NM_010493]    
Forward ATAACTGGACTATAATCATTCTG 119 57
Reverse AGCCTTCTGTAACTTGTAT   
E-selectin [GenBank: M87862]    
Forward CATGACGTATGATGAAGC 98 57
Reverse GATTGGAGTTAAGGTAGTTG   
VCAM-1 [GenBank: NM_011693]    
Forward CTCTAGCAAGACCCTTTA 149 57
Reverse CATCTTCACAGGCATTTC   
  1. *bp, base pair; # Tm, Melting temperature.