Skip to main content

Table 1 List of PCR primers

From: Putative role of protein kinase C in neurotoxic inflammation mediated by extracellular heat shock protein 70 after ischemia-reperfusion

Gene Oligonucleotides
Myd88 Forward CTTGATGACCCCCTAGGACA
Reverse AGGCTGAGTGCAAACTTGGT
Trif Forward AGACCCCTACAGCCAGGTCT
Reverse GGCATGGAGAAGCTTTGACT
Ripk1 Forward TGATGCACGTGCTAAAGACC
Reverse TGTTCGGGTGCCATGTAGTA
Il1b Forward GACCTTCCAGGATGAGGACA
Reverse AGGCCACAGGTATTTTGTCG
Tnf Forward CAAAATTCGAGTGACAAGCCTG
Reverse GAGATCCATGCCGTTGGC
Ccl2 Forward AGGTCCCTGTCATGCTTCTG
Reverse ATTTGGTTCCGATCCAGGTT
Ccl5 Forward AGCAGCAAGTGCTCCAATCT
Reverse ATTTCTTGGGTTTGCTGTGC
Cxcl10 Forward GCTGCAACTGCATCCATATC
Reverse CACTGGGTAAAGGGGAGTGA
Icam1 Forward TGGTGATGCTCAGGTATCCA
Reverse CACACTCTCCGGAAACGAAT
Ncf1 Forward CGAGAAGAGTTCGGGAACAG
Reverse AGCCATCCAGGAGCTTATGA
Nox2 Forward GACTGCGGAGAGTTTGGAAG
Reverse ACTGTCCCACCTCCATCTTG
Nos2 Forward CAGAGGACCCAGAGACAAGC
Reverse TGCTGAAACATTTCCTGTGC
Sdha Forward ACACAGACCTGGTGGAGACC
Reverse GCACAGTCAGCCTCATTCAA
Actb Forward CACCCTGTGCTGCTCACC
Reverse GCACGATTTCCCTCTCAG