Skip to main content

Table 1 Primer sequences used in the real time RT-PCR

From: Intermittent fasting attenuates lipopolysaccharide-induced neuroinflammation and memory impairment

Gene Sequence
iNos [GenBank: MN_0126113] Forward 5′ AAAATGGTTTCCCCCAGTTC 3′
Reverse 5′ GTCGATGGAGTCACATGCAG 3′
Tlr-4 [GenBank: MN_019178.1] Forward 5′ GGATGATGCCTCTCTTGCAT 3′
Reverse 5′ TGATCCATGCATTGGTAGGTAA 3′
Hprt [GenBank: MN_012583.2] Forward 5′ CTCATGGACTGATTATGGACAG 3′
  Reverse 5′ GCAGGTCAGCAAAGAACTTATA 3′