Skip to main content

Advertisement

Table 1 Primer sequences used for qRT-PCR.

From: Parecoxib is neuroprotective in spontaneously hypertensive rats after transient middle cerebral artery occlusion: a divided treatment response?

Gene Forward primer (5' → 3') Reverse primer (5' → 3') Accession no.
COX-1 GTACTATCCCTGAGATCTGGAC TGAGTACTTCTCGGATGAAGG S67721
COX-2 TGAGATACGTGTTGACGTCC TTCCTTATTTCCTTTCACACCC S67722
TNF-α CTCTTCTCATTCCTGCTCGT GAGAAGATGATCTGAGTGTGAG AJ002278
IL-1β CATAAGCCAACAAGTGGTATTCTC TGTTTGGGATCCACACTCTC NM_031512
IL-6 CAGGGAGATCTTGGAAATGAG GGCAAATTTCCTGGTTATATCC NM_012589
β-actin TGACGGTCAGGTCATCACTATC TGACGGTCAGGTCATCACTATC NM_031144