Skip to main content

Table 1 Murine primer sequences used for real-time RT-PCR analysis of intracerebral gene expression

From: Inhibition of the alternative complement activation pathway in traumatic brain injury by a monoclonal anti-factor B antibody: a randomized placebo-controlled study in mice

  Gene ID at NCBI * GeneBank Accession No. Length of amplicons Primer sequence Probe Sequence Order No. Qiagen
GAPDH # 14433 NM_008084 136 bp commercially available Genexpression Assay QuantiTect Mm_GAPD 241012
Bcl-2 12043 NM_009741
NM_177410
118 bp commercially available Genexpression Assay QuantiTect Mm_Bcl-2 241118
Fas 14102 NM_007987 96 bp commercially available Genexpression Assay QuantiTect Mm_ Tnfsf6 241122
C1-Inh 12258 NM_009776 134 bp AACTTAGAACTCATCAACACCT
GTTATCTTCCACTTGGCACTC
ACACCTGCCTCGTCCT custom made
  1. * NCBI, National Center for Biotechnology Information
  2. # Housekeeping gene