Skip to main content

Table 1 TaqMan reagent sequences

From: Repeated administration of the noradrenergic neurotoxin N-(2-chloroethyl)-N-ethyl-2-bromobenzylamine (DSP-4) modulates neuroinflammation and amyloid plaque load in mice bearing amyloid precursor protein and presenilin-1 mutant transgenes

Gene Reagent Sequences
MIP-1α F; AGCTGACACCCCGACTGC
  R; GTCAACGATGAATTGGCGTG
  P; TGCTGCTTCTCCTACAGCCGGAAGAT
MIP-1β F; AGCTCTGCGTGTCTGCCC T
  R; GCTGAGAACCCTAGAGCACA
  P; TCTCCT CTTGCTCGTGGCTGCCTT
TNFα F; TCCAGGCGGTGCCTATGT
  R; GAGCGTGGTGGCCCC
  P; TCAGCCTCTTCTCATTCCTGCTTGTGG
iNOS F; TGATGTCCGAAGCAAACATCA
  R; TGTGGCTCCCATGTTGCAT
  P; TTCAGATCCCGAAACGCTTCACTTCC
IL-1β F; TTGGGCCTCAAAGGAAAGAAT
  R; TCTCCAGCTGCAGGGTGG
  P; TATACCTGTCCTGTGTAATGAAAGACGGCA CA
IκBα F; CGGAGGACGGAGGACTCGTT
  R; ACTTCCATGGTCAGCGGCT
  P; TGCACTTGGCAATCATCCACGAAGA
FasL F; TACCACCGCCATCACAACC
  R; TTTGTGTTGTGGTCCTTCTTCTTTAG
  P; CTCCCACTGCCGCCACTGACC
GFAP F; GGAGCTCAATGACCGCTTTG
  R; AGCGCCTTGTTTTGCTGCTC
  P; CAGCTACATCGAGAAGGTTCG
RANTES F; TCTTGCAGTCGTGTTTGTCAC
  R; TCTTGAACCCACTTCTTCTCT
  P; AGGAACCGCCAAGTGTGTGC
CCR5 F; GGAATGACACACTGCTGCCTAA
  R; GAACACTGAGAGATAACTCCGGAAC
  P; CCCTGTCATCTATGCCTTTGTTGGAGAGA