Skip to main content

Advertisement

Table 1 Sequences of primers used for rt-PCR

From: Characterization of early and terminal complement proteins associated with polymorphonuclear leukocytes in vitro and in vivo after spinal cord injury

  Forward (5' to 3') Reverse (5' to 3') Reference or Accession Number
C1q CGACTATGCCCAAAACACCT GGAAAAGCAGAAAGCCAGTG Fan et al. 2004
C3 GACCTGCGACTGCCCTACTCT CTGATGAAGTGGTTGAAGACG X52477
C4 AGACCCGCAACTTTCTGGTCC TGAGCTCAGGGATCCAGAGTC U42719
C5 GACCTGCAGCTCCTGCATCAGA CCTTCCCAACAGCATGCCTTTGT X91892
C6 GGGGCAAGTATGACCTTCTC TGGGGACCGTTTTTCACAGT Qian et al. 1999
C7 CAGAATTCTGTCCATCACCTC GAATTCTGCAG1TFCTCCCAG Oka et al. 2001
C9 TAATGGTGACAACGACTGTGG TGACAAGTAGGATGACAATCG U52948
CD59 ATGCTACAACTGTTTAGACCC CTTCGAAGCTTTTGTTACACAAGT U48225
Crry GTTCTTGATGGAGTGGAAAGC CTGAGGCTGAACACAGCTGTC Sohn et al. 2000
GADPH TGAAGGTCGGTGTCAACGGATTTGGC CATGTAGGCCATGAGGTCCACCAC Sohn et al. 2000