Skip to main content

Table 1 Primer sequence table

From: Expression of P2 nucleotide receptors varies with age and sex in murine brain microglia

Gene Forward primer Reverse primer Average Ct (vs. β-actin) for 3d samples
P2X1 CAGAAAGGAAAGCCCAAGGTATT CACGTCTTCACAGTGCCATTG +9
P2X2 GCTGCTCATTCTGCTTTACTTCG TCCCACACTTTGTGTTCCGA N.A.
P2X3 AAGGCTTCGGACGCTATGC GATGACAAAGACAGAAGTGCCCT +16
P2X4 AGACGGACCAGTGATGCCTAAC TGGAGTGGAGACCGAGTGAGA +6
P2X5 GATGTGGCAGACTTTGTCATTCC CCTTCACGCTCAGCACAGATG +4
P2X6 ACGTGTTCTTCCTGGTAACCAACT TGGACATCTGCCCTGGACTT +13
P2X7 ACAATGTGGAAAAGCGGACG TCAATGCACACAGTGGCCA +4
P2Y1 AGCAGAATGGAGACACGAGTTTG GGGATGTCTTGTGACCATGTTACA +16
P2Y2 GAAGAACTGGAGCAGGCGCT CCATTGCCCTGGACCTGATC +12
P2Y4 CTGCAAGTTCGTCCGCTTTC GTATTGCCCGCAGTGGATG +16
P2Y6 TGAAAACAACGAGGAACACCAA CAGCCTTTCCTATGCTCGGA +6
P2Y12 CACAGAGGGCTTTGGGAACTTA TGGTCCTGCTTCTGCTGAATC +3
P2Y13 CAGCTGAGTCTCTTCCAAAACAAA TGCATCCCAGTGGTGTTGAT +5
P2Y14 CCACCACAGACCCTCCAAAC CAACACGGGAATGATCTGCTTT +14