Skip to main content

Table 1 Primer pairs and Roche library probes for real time qRT-PCR validation

From: Luteolin triggers global changes in the microglial transcriptome leading to a unique anti-inflammatory and neuroprotective phenotype

Gene F-Primer (5'-3') R-Primer (5'-3') Roche Library Probe
AA467197 aaatggtggatcctactcaacc gttgccctccggactttt 17
Blvrb tcctcggagttctcagcttt gcaccgtcacctcataacct 81
C3 accttacctcggcaagtttct ttgtagagctgctggtcagg 76
CD36 ttgaaaagtctcggacattgag tcagatccgaacacagcgta 6
CD83 gctctcctatgcagtgtcctg ggatcgtcagggaataggc 2
Cfb ctcgaacctgcagatccac tcaaagtcctgcggtcgt 1
Cst7 atgtcagcaaagccctggta ggtcttcctgcatgtagttcg 67
Cxcl10 gctgccgtcattttctgc tctcactggcccgtcatc 3
Ddit3 ccaccacacctgaaagcag tcctcataccaggcttcca 33
Gbp2 tgtagaccaaaagttccagacaga gataaaggcatctcgcttgg 62
Gbp3 aagattgagctgggctacca gaaactcttgagaacctcttttgc 73
Gclm tggagcagctgtatcagtgg caaaggcagtcaaatctggtg 18
Gusb gtgggcattgtgctacctg atttttgtcccggcgaac 25
Hmox1 ctgctagcctggtgcaaga ccaacaggaagctgagagtga 25
Hp ccctgggagctgttgtca ctttgggcagctgtcatctt 15
Hprt1 tcctcctcagaccgctttt cctggttcatcatcgctaatc 95
Ifi44 ctgattacaaaagaagacatgacagac aggcaaaaccaaagactcca 78
Ifitm3 aacatgcccagagaggtgtc accatcttccgatccctagac 84
Ifitm6 ccggatcacattacctggtc catgtcgcccaccatctt 27
IL-6 gatggatgctaccaaactggat ccaggtagctatggtactccaga 6
iNos ctttgccacggacgagac tcattgtactctgagggctga 13
Irf7 cttcagcactttcttccgaga tgtagtgtggtgacccttgc 25
Kdr cagtggtactggcagctagaag acaagcatacgggcttgttt 68
Lcn2 atgtcacctccatcctggtc cctgtgcatatttcccagagt 1
Lpcat1 aatgtgaggcgtgtcatgg ggcagtcctcaaatgtatagtcg 81
Marco cagagggagagcacttagcag gccccgacaattcacatt 20
Mpeg1 cacagtgagcctgcacttaca gcgctttcccaatagcttta 69
Nupr1-F gatggaatcctggatgaatatga gtccgacctttccgacct 64
Rnf145 catggacttctggcttctcat aataaaaagtgttcccagaacctg 67
Saa3 atgctcgggggaactatgat acagcctctctggcatcg 26
Slpi gtgaatcctgttcccattcg cctgagttttgacgcacctc 69
Srxn1 gctatgccacacagagaccata gtgggaaagctggtgtcct 33
Trib3 gctatcgagccctgcact acatgctggtgggtaggc 98