Skip to main content

Table 1 Primers used for RT-PCR

From: Cerebrovascular expression of proteins related to inflammation, oxidative stress and neurotoxicity is altered with aging

Gene Orientation Sequence Amplicon
Size (bp)
IL-1β Left primer AGCAGCTTTCGACAGTGAGGAGAA 182
  Right primer TCTCCACAGCCACAATGAGTGACA  
IL-6 Left primer CCGGAGAGGAGACTTCACAG 428
  Right primer GAGCATTGGAAGTTGGGGTA  
GAPDH Left primer TCTGCATCTGGCAAAGTGGAGACT 101
  Right primer TTGAACTTGCCGTGGGTAGAGTCA