Skip to main content

Table 1 Primers used for RT-qPCR analysis.

From: Acute paretic syndrome in juvenile White Leghorn chickens resembles late stages of acute inflammatory demyelinating polyneuropathies in humans

Gene Forward Reverse
18S rRNA TGTCTAAGTACACACGGGCGGTACA GGCGCTCGTCGGCATGTATTA
CD3ε CATCGCTGCGGATCTTCTCA GCTGCATCTTCTGGGCTCGT
chB6 GATCGCCTGCCCTCCAAT TGGCTTTCCACGTCAGCTATC
Blimp-1 GTGGTATTGCCGAGACTTTGC GGGTTTGTGTGAGGTTCATCATT
AID CGTCTGAAACCCAGCAAGAGT TGTCCATGTCAGCTGGGTTCT
iNOS AAGCAAACGGCCAAGATCCA CCCACCTCAAGGAGCATGTTG
IFNγ TGGCGTGAAGAAGGTGAAAGA TCTGAGACTGGCTCCTTTTCCT
IL-1 CTGAGTCATGCATCGTTTATGTTTC AAATACCTCCACCCCGACAAG
IL-6 GCTTCGACGAGGAGAAATGC GCCAGGTGCTTTGTGCTGTA
IL-10 CGGGAGCTGAGGGTGAAGT CAGCCAAAGGTCCCCTTAAAC
IL-13 GCCACAGTGCTGGACAACAT ATGCCGTGCAGGCTCTTC