Skip to main content

Advertisement

Table 1 Primer sequences used for qRT-PCR

From: Pro-inflammatory cytokines derived from West Nile virus (WNV)-infected SK-N-SH cells mediate neuroinflammatory markers and neuronal death

Gene Primer Sequence (5'-3') Amplicon
[GenBank No.]   (bp) Tm (°C)
IL-1β    
[GenBank:NM_000576]    
   Forward AGCACCTTCTTTCCCTTCATC 86 56
   Reverse GGACCAGACATCACCAAGC   
IL-6    
[GenBank:NM_000600]    
   Forward CCAGGAGCCCAGCTATGAAC 84 57
   Reverse CCCAGGGAGAAGGCAACTG   
IL-8    
[GenBank:NM_000584]    
   Forward GAACTGAGAGTGATTGAGAGTGGA 91 55
   Reverse CTCTTCAAAAACTTCTCCACAACC   
TNF-α    
[GenBank:NM_000594]    
   Forward CCTGCCCCAATCCCTTTATT 81 55
   Reverse CCCTAAGCCCCCAATTCTCT