Skip to main content

Table 1 Oligonucleotide primer sets used in quantitative real time RT-PCR analysis

From: Strain-dependent variation in the early transcriptional response to CNS injury using a cortical explant system

  Sense Primer Sequence Amplicon Size Assession# Name
β-Actin Forward GGCTGTATTCCCCTCCATC 141 bp NM_007393.2 actin, beta, cytoplasmic
  Reverse ATGCCATGTTCAATGGGGTA    
ASF Forward CAGATCGCCTACGCCATGCAGA 81 bp NM_008951.1 antisecretory factor
  Reverse GGCTGAGCTGGCATCCATGTCA    
CCL2 Forward ACCACCATGCAGGTCCCTGTCAT 75 bp NM_011333.3 chemokine (C-C motif) ligand 2 (MCP-1)
  Reverse AGCCAACACGTGGATGCTCCAG    
CCL3 Forward ACCAGCAGCCTTTGCTCCCA 141 bp NM_011337.2 chemokine (C-C motif) ligand 3 (MIP-1alpha)
  Reverse TCCTCGCTGCCTCCAAGACTCT    
CCL4 Forward TGCTCGTGGCTGCCTTCTGT 99 bp NM_013652.2 chemokine (C-C motif) ligand 4 (MIP-1beta)
  Reverse TGTGAAGCTGCCGGGAGGTGTA    
CD74 Forward CATGGATGACCAACGCGAC 101 bp NM_010545.3 invariant polypeptide of major histocompatibility complex, class II antigen-associated
  Reverse TGTACAGAGCTCCACGGCTG    
CiiTA Forward GCATGTTGCACACCAGCTCCCT 135 bp NM_007575.2 major histocompatibility complex class II transactivator
  Reverse ACGCCAGTCTGACGAAGGTCCA    
COX-2 Forward CAGACAACATAAACTGCGCCTT 71 bp NM_011198.3 prostaglandin-endoperoxide synthase 2 (Ptgs2)
  Reverse GATACACCTCTCCACCAATGACC    
IL-1α Forward TACTCGTCGGGAGGAGACGACTCT 107 bp NM_010554.4 interleukin 1 alpha
  Reverse TCCTTCAGCAACACGGGCTGGT    
IL-1β Forward CCTTCCAGGATGAGGACATGA 71 bp NM_008361.3 interleukin 1 beta
  Reverse TGAGTCACAGAGGATGGGCTC    
IL-6 Forward GAGGATACCACTCCCAACAGACC 141 bp NM_031168.1 interleukin 6
  Reverse AAGTGCATCATCGTTGTTCATACA    
IL-12 P35 Forward GCATGCTGGTGGCCATCGATGA 130 bp NM_008351.1 interleukin 12, alpha subunit p35
  Reverse GCGTGAAGCAGGATGCAGAGCT    
IL-12/23 P40 Forward TGTGCTCGTGGCCTGATCCACT 91 bp NM_008352.2 interleukin 12,23, beta subunit p40
  Reverse CGCAGCCCTGATTGAAGAGCTGT    
IL-23 P19 Forward TATGGCTGTTGCCCTGGGTCACT 118 bp NM_031252.2 interleukin 23, alpha subunit p19
  Reverse GCATGTGCGTTCCAGGCTAGCA    
TNF-α Forward CAAGGGACAAGGCTGCCCCG 109 bp NM_013693.2 tumor necrosis factor alpha
  Reverse GCAGGGGCTCTTGACGGCAG