Skip to main content

Table 1 Primer sequences used for RT-PCR

From: Expression of sphingosine kinase 1 in amoeboid microglial cells in the corpus callosum of postnatal rats

Name Forward Reverse Size
(bp)
TNF-α ccaacaaggaggagaagttcc ctctgcttggtggtttgctac 134
IL-1β ggaacccgtgtcttcctaaag ctgacttggcagaggacaaag 123
SphK1 tcagtctgtcctggggtttc tcctccagaggaacgaggta 226
β- actin tcatgaagtgacgttgacatccgt cctagaagcatttgcggtgcaggatg 285