Skip to main content

Table 1 Primer sequences used in RT-qPCR

From: Differential aquaporin 4 expression during edema build-up and resolution phases of brain inflammation

Gene Accession number Primer sequences from 5' to 3' Location of amplicon Amplicon length Efficiency
AQP4 Isoform 1: NM_012825.3 Sens: TTGGACCAATCATAGGCGC 770 to 788 Isoform 1 213 pb 98.2%
    778 to 796 Isoform 2   
  Isoform 2: NM_001142366.1 Revs: GGTCAATGTCGATCACATGC 963 to 982 Isoform 1   
    971 to 990 Isoform 2   
GFAP NM_017009.2 Sens: GCGGCTCTGAGAGAGATTCG 692 to 711 90 pb 102.0%
   Revs: TGCAAACTTGGACCGATACCA 761 to 781   
IL1β NM_031512.2 Sens: AATGACCTGTTCTTTGAGGCTGAC 111 to 134 115 pb 91.2%
GAPDH NM_017008.3 Sens: TGCTGGTGCTGAGTATGTCGTG 337 to 358 101 pb 89.5%