Skip to main content

Table 1 Gene-specific real time RT-PCR primer sequences.

From: Effects of betaine on lipopolysaccharide-induced memory impairment in mice and the involvement of GABA transporter 2

Gene   Sequence (5'-3')
ß-actin forward TGACAGGATGCAGAAGGAGA
  reverse GCTGGAAGGTGGACAGTGAG
CD11b forward TCACCCTCAAGGGCAACCTATC
  reverse AGGGCAAACGCAGAGTCATTAAAC
CD45 forward TCCCAGCAGACAGGGTTGTTC
  reverse GTCCATTCTGGGCGGGATAG
COX-2 forward GTGTGCGACATACTCAAGCAGGA
  reverse TGAAGTGGTAACCGCTCAGGTG
GAT2 forward CCATCTTGGGCTTCATGTCTCA
  reverse CAGCTGGGACAAAGGCATCA
GFAP forward ACCAGCTTACGGCCAACAGTG
  reverse TGTCTATACGCAGCCAGGTTGTTC
IL-1ß forward TCCAGGATGAGGACATGAGCAC
  reverse GAACGTCACACACCAGCAGGTTA
IL-6 forward CCACTTCACAAGTCGGAGGCTTA
  reverse GCAAGTGCATCATCGTTGTTCATAC
iNOS forward GGAATGGAGACTGTCCCAGCA
  reverse GTCATGAGCAAAGGCGCAGA
Heme oxygenase-1 forward TGCAGGTGATGCTGACAGAGG
  reverse TGTCTGGGATGAGCTAGTGCTGA
TNF-α forward AAGCCTGTAGCCCACGTCGTA
  reverse GGCACCACTAGTTGGTTGTCTTTG