Skip to main content

Table 1 The sequences of primers and probes used to amplify cytokine cDNA

From: Temporal profiles of age-dependent changes in cytokine mRNA expression and glial cell activation after status epilepticus in postnatal rat hippocampus

Cytokine 5' primer 3' primer Probe
GDNF GCCACCATCAAAAGACTGAAAAG CGGTTCCTCTCTCTTCGAGGA TCACCAGATAAACAAGCGGCGGCA
IFN-γ TCGAATCGCACCTGATCACTA GGGTTGTTCACCTCGAACTTG CATCCTTTTTTGCTTTACTGTTGCTGAGAAG
IL-1β GAAAGACGGCACACCCACC AAACCGCTTTTCCATCTTCTTCT TGCAGCTGGAGAGTGTGGATCCCAAAC
IL-10 CCCTCTGGATACAGCTGCG GCTCCACTGCCTTGCTTTTATT CGCTGTCATCGATTTCTCCCCTGTGA
MMP-9 GTATGGTCGTGGCTCTAAACCTG TCGGCTGTGGTTCAGCTG CCCAAGGCCTCCAGCCACCAC
TGF-β1 TGAGTGGCTGTCTTTTGACGTC CCTGTATTCCGTCTCCTTGGTT CTGGAGTTGTCCGGCAGTGGCTGA
TNF-α GACCCTCACACTCAGATCATCTTCT ACGCTGGCTCAGCCACTC TAGCCCACGTCGTAGCAAACCACCAA
  1. The probes were labeled with FAM at the 5' end and with TAMRA at the 3' end.