Skip to main content

Table 2 Primers used for quantitative real-time PCR

From: Transcellular migration of neutrophil granulocytes through the blood-cerebrospinal fluid barrier after infection with Streptococcus suis

Gene Primer Sequence (5' → 3')
ICAM-1 forward CACAGGCCGCCACTAACAA
ICAM-1 reverse GGTTCCATTGATCCAGGTCTT
VCAM-1 forward GCACGAGCTTCCTGAGCACTT
VCAM-1 reverse CTGTGTGACGAGGAAACAATG
β-actin forward TCCAGAGGCGCTCTTCCA
β-actin reverse CGCACTTCATGATCGAGTTGA
  1. ICAM, intracellular adhesion molecule; VCAM, vascular cell adhesion molecule