Skip to main content

Table 1 DNA primer sequences for real-time PCR

From: TLR4 mutation reduces microglial activation, increases Aβ deposits and exacerbates cognitive deficits in a mouse model of Alzheimer's disease

Gene Forward primer (5' to 3') Reverse primer (5' to 3')
IL-1α AGGAGAGCCGGGTGACAGTA AACTCAGCCGTCTCTTCTTCAGA
IL-1ß TGGTGTGTGACGTTCCCATT CAGCACGAGGCTTTTTTGTTG
IL-4 ACAGGAGAAGGGACGCCAT GAAGCCCTACAGACGAGCTCA
IL-6 GAGGATACCACTCCCAACAGACC AAGTGCATCATCGTTGTTCATACA
IL-10 GGTTGCCAAGCCTTATCGGA ACCTGCTCCACTGCCTTGCT
TNF-α TCCAGGCGGTGCCTATGT CGATCACCCCGAAGTTCAGTA
TGF-β TGACGTCACTGGAGTTGTACGG GGTTCATGTCATGGATGGTGC
IFN-γ TGAACGCTACACACTGCATCTTG GTTATTCAGACTTTCTAGGCTTTCAATG
CCL2 TGAATGTGAAGTTGACCCGT AAGGCATCACAGTCCGAGTC
CCL3 CCTCTGTCACCTGCTCAACA GATGAATTGGCGTGGAATCT
CCL4 CCCACTTCCTGCTGTTTCTC GAGGAGGCCTCTCCTGAAGT
CCL6 GCCACACAGATCCCATGTAA GCAATGACCTTGTTCCCAGA