Skip to main content

Table 1 Primers and probes

From: Innate Immunity in multiple sclerosis white matter lesions: expression of natural cytotoxicity triggering receptor 1 (NCR1)

GAPDH Assay ID Hs.PT.42.1164609
  Probe 5'-/5HEX/TGC GGT CAC CAT CAATGA AGA GCA/3IABkFQ/-3'
  Primer 1 5'-CGC AAT CAT AGG ACT AGA GAC G-3'
  Primer 2 5'-GAT CCT GTATTC GGCTTC CAG-3'
NCR1 Assay ID Hs.PT.1994249
  Probe 5'-/56-FAM/CGAGAGGGT/ZEN/GGGTGTGTCATACATTTC/3IABkFQ/-3'
  Primer 1 5'- TCTAGACGGCAGTAGAAGGTC -3'
  Primer 2 5'- CTTGCTGGATCTGGTGGTAA -3'
XPNPEP1 Assay ID Hs.PT.42.500129
  Probe 5'-/5HEX/TGCGGTCACCATCAATGAAGAGCA/3IABkFQ/-3'
  Primer 1 5'- CGCAATCATAGGACTAGAGACG -3'
  Primer 2 5'- GATCCTGTATTCGGCTTCCAG -3'