Skip to main content

Table 1 List of PCR primers used in the study

From: Telmisartan directly ameliorates the neuronal inflammatory response to IL-1β partly through the JNK/c-Jun and NADPH oxidase pathways

Gene Accession number Forward primer (5′→3′) Reverse primer (5′→3′)
hAT1 S77410 ACCGCCCCTCAGATAATGTAAG TGAAGTGCTGCAGAGGAATGTT
hCOX-2 NM_000963 GATTGCCCGACTCCCTTGG AACTGATGCGTGAAGTGCTG
hGAPDH NM_002046 CCCATCACCATCTTCCAGGAG GTTGTCATGGATGACCTTGGCC
hIκB-α NM_020529 CGGACTGCCCTTCACCTC ACATCAGCCCCACACTTCAA
hIL-1R1 NM_000877 AGAGGAAAACAAACCCACAAGG CTGGCCGGTGACATTACAGAT
hNOX-1 NM_013955 ATCACAACCTCACCTTCCAC ATAGGCTGGAGAGAATGGA
hNOX-2 NM_000397 CCCTTTGGCACTGCCAGTGAAGAT CAATCCCTGCTCCCACTAACATCA
hNOX-4 NM_016931 GGATCACAGAAGGTTCCAAGCAG GCAGCCACATGCACGCCTGAGAA
hNOX-5 NM_024505 ATCAAGCGGCCCCCTTTTTTTCAC CTCATTGTCACACTCCTCGACAGC
rAT1A NM_030985 AGCCTGCGTCTTGTTTTGAG GCTGCCCTGGCTTCTGTC
rCOX-2 AF233596 CGGAGGAGAAGTGGGGTTTAGGAT TGGGAGGCACTTGCGTTGATGG
rGAPDH NM_017008 ATGACTCTACCCACGGCAAG TGGAAGATGGTGATGGGTTT
rIL-1R1 NM_013123 TGAATGTGGCTGAAGAGCAC CTTCCATCGTCTCATTCCGT
  1. h, human; r, rat.
  2. For AT1 receptor mRNA expression, the products of PCR amplification were separated on 3 % agarose gel and visualized with ethidium bromide to verify the size of amplicon.