Skip to main content

Advertisement

Table 1 Primer sequences

From: Efficient isolation of live microglia with preserved phenotypes from adult mouse brain

  Direction Sequence 5′→3′
18 S Forward CGGGTGCTCTTAGCTGAGTGTCCCG
Reverse CTCGGGCCTGCTTTGAACAC
CD11b Forward AAGGATTCAGCAAGCCAGAA
Reverse GGAGGGATGAGAGTCCACAT
GFAP Forward TGCTGGAGGGCGAAGAAAACCG
Reverse TTTGGTGCTTTTGCCCCCTCGG
NeuN Forward GTTGCCTACCGGGGTGCACAC
Reverse TGCTCCAGTGCCGCTCCATAAG
TNF-α Forward TGTAGCCCACGTCGTAGCAA
  Reverse AGGTACAACCCATCGGCTGG