Skip to main content

Table 1 List of PCR primers used in the study

From: Plasminogen activator inhibitor type 1 regulates microglial motility and phagocytic activity

Name Accession number   Forward primer (5′→3′)
Reverse transcriptase PCR
LRP1 NM_008512 Forward GCGTGGGTGTGTGATGGCGA
   Reverse GTTGCGCAGGCCAGGCACTA
PAI-1 NM_008871 Forward GTCTTTCCGACCAAGAGCAG
   Reverse GCCGAACCACAAAGAGAAAG
TLR2 NM_011905.3 Forward ACAGCTACCTGTGTGACTCTCCGCC
   Reverse GGTCTTGGTGTTCATTATCTTGCGC
TLR6 NM_011604.3 Forward CTGCCCTGGTATGTGAGGAT
   Reverse TCTGGATGAAGTGGGGAGAC
Dectin-1 AY534909.1 Forward GACTTCAGCACTCAAGACATCC
   Reverse TTGTGTCGCCAAAATGCTAGG
β-actin NM_007393.3 Forward ATCCGTAAAGACCTCTATGC
   Reverse AACGCAGCTCAGTAACAGTC
Real-time PCR  
PAI-1 NM_008871 Forward CATGCCCCACTTCTTCAAGCT
   Reverse TGGTATGCCTTTCCACCCAGT
GAPDH NM_008084.2 Forward TGGGCTACACTGAGCACCAG
   Reverse GGGTGTCGCTGTTGAAGTCA
  1. LRP, Low-density lipoprotein receptor-related protein; PAI, plasminogen activator inhibitor; TLR, Toll-like receptor.