Skip to main content

Table 1 Primers used for qRT-PCR

From: Characterization and function of the human macrophage dopaminergic system: implications for CNS disease and drug abuse

Primer Forward primer sequence (5′ - 3′) Reverse primer sequence (5′-3′)
β-actin CTCTTCCAGCCTTCCTTCCT AGCACTGTGTTGGCGTACAG
DRD1 AGGGGAATTTGCAGTTCTGT AAAAGATGGAGAGGGCCAAT
DRD2 GCAGACCACCACCAACTACC CCACTCACCTACCACCTCCA
DRD3 CACTGTCTGCTCCATCTCCA GAGGATCCTTTTCCGTCTCC
DRD4 CCTTCTTCGTGGTGCACAT AACTCGGCGTTGAAGACAGT
DRD5 GCCTACCAGAGATGGACCAA AAAAGGGAGGGGAGAGCATA
TH GTGAGGTTGTGCTGCCTGT CTTTTATTGTGACGGTGATTGG
AADC CGAGCAGAGAGGGAGTAGGA CCACAGACAGCTGAGTTCCA
VMAT2 TTGAGGGTTTCTGGTTCTCC ATACCTTTGCCAGGCCTTCT
DAT CGAGCCTGCTTGCTGATATT ATGGCATCCACTTTCCTGTC