Skip to main content

Table 1 The sequences of the RNA oligoribonucleotides used for transfection

From: The microRNA miR-181c controls microglia-mediated neuronal apoptosis by suppressing tumor necrosis factor

Name Direction Sequence (5′→3′)
miR-181c mimic Forward AACAUUCAACCUGUCGGUGAGU
  Reverse UCACCGACAGGUUGAAUGUUUU
NC Forward UUCUCCGAACGUGUCACGUTT
  Reverse ACGUGACACGUUCGGAGAATT
TNF-α siRNA Forward UGAGGUCAAUCUGCCCAAGUACUUA
  Reverse UAAGUACUUGGGCAGAUUGACCUCA
  1. miR, microRNA; NC, negative control; TNF-α siRNA, tumor necrosis factor-α small interfering RNA.