Skip to main content

Table 1 Primers for real-time PCR amplification

From: Transgenic inhibition of astroglial NF-κB protects from optic nerve damage and retinal ganglion cell loss in experimental optic neuritis

Gene Oligonucleotides PCR product size
IL-1β Forward GACCTTCCAGGATGAGGACA 283 bp
Reverse AGGCCACAGGTATTTTGTCG
CCL5 Forward AGCAGCAAGTGCTCCAATCT 280 bp
Reverse ATTTCTTGGGTTTGCTGTGC
CXCL10 Forward GCTGCAACTGCATCCATATC 293 bp
Reverse CACTGGGTAAAGGGGAGTGA
ICAM-1 Forward TGGTGATGCTCAGGTATCCA 273 bp
Reverse CACACTCTCCGGAAACGAAT
TNF Forward CAAAATTCGAGTGACAAGCCTG 113 bp
Reverse GAGATCCATGCCGTTGGC
NOS2 Forward CAGAGGACCCAGAGACAAGC 299 bp
Reverse TGCTGAAACATTTCCTGTGC
Cybb/NOX2 Forward GACTGCGGAGAGTTTGGAAG 258 bp
Reverse ACTGTCCCACCTCCATCTTG
Ncf1 Forward CGAGAAGAGTTCGGGAACAG 286 bp
Reverse AGCCATCCAGGAGCTTATGA
β-actin Forward CACCCTGTGCTGCTCACC 327 bp
  Reverse GCACGATTTCCCTCTCAG