Skip to main content

Table 1 Primer sequences

From: TNF-α protein synthesis inhibitor restores neuronal function and reverses cognitive deficits induced by chronic neuroinflammation

Gene GenBank accession number Forward primer 5'→3' Reverse primer 5'→3'
CD200 AF231392 GTCCTTGGATGGGCATTTA TGCGGAGATTCACCACAA
Cyclophilin NM_017101 AGCATACAGGTCCTGGCATC TTCACCTTCCCAAAGACCAC
CX3CL1 NM_134455.1 ATCCCAGTGACCTTGCTCATCC AAGTGTCTGTGCTGTCTCGTCTCC
Hmgb1 NM_012963 GAGCACAAGAAGAAGCACCC TAACGAGCCTTGTCAGCCTT
IL-1β NM_031512 CACCTCTCAAGCAGAGCACAGA ACGGGTTCCATGGTGAAGTC
IL-4 NM_201270 CAGGGTGCTTCGCAAATTTT CTCAGTTCACCGAGAACCCC
IL-6 NM_012589 GCCAGAGTCATTCAGAGCAA CATTGGAAGTTGGGGTAGGA
IRAK1 NM_001127555 ACCTCCCTGGAAGCTAGAGG AGAGGCCAGGAACACTCTCA
NfκB p65 NM_199267 ACGATCTGTTTCCCCTCATCT TGCTTCTCTCCCCAGGAATA
TLR2 NM_198769 TGGAGACTCTGGAAGCAGGT CGCCTAAGAGCAGGATCAAC
TLR4 NM_019178 GAGGACTGGGTGAGAAACGA AGATACACCAACGGCTCTG
TNF-α NM_013693 GTGATCGGTCCCAACAAG AGGGTCTGGGCCATGGAA
TNFR1 NM_013091 GCTGCACCAAGTGCCACAA TCACACACCTCGCAGACTGTTTC
TNFR2 NM_130426 CACACATCCCTGTGTCCTTG AAGCAGTTCGCCAGTCCTAA