Skip to main content

Table 1 Primer sequences used for real-time reverse transcriptase PCR

From: Opposing effects of Toll-like receptors 2 and 4 on synaptic stability in the spinal cord after peripheral nerve injury

Primer   Sequence5→3
β2-microglobulin Forward ATGGCTCGCTCGGTGACCCTG
  Reverse CCGGTGGGTGGCGTGAGTATACTT
GAPDH Forward TGCACCACCAACTGCTTA
  Reverse GGATGCAGGGATGATGTTC
IL-6 Forward AGTGGCTAAGGACCAAGACCATCCA
  Reverse 5GGCATAACGCACTAGGTTTGCCGA
IL-1β Forward 5GAGCTTGACGGCACCCTCGC
  Reverse AGCTTCGTGGCTGTGGAAAAAGTGT
BDNF Forward 5 CACTCCGACCCTGCCCGC
  Reverse CCCGCCAGACATGTCCAC
GDNF Forward 5 TGCCCGCCGGTAAGAGGCTT
  Reverse TGGAGTCACTGGTCAGCGCGAA
  1. BDNF, brain-derived neurotrophic factor; GADPH, glyceraldehyde 3-phosphate dehydrogenase; GDNF, glial cell-derived neurotrophic factor; IL, interleukin.