Skip to main content

Table 1 Primers used in the experiments

From: Microglial TIR-domain-containing adapter-inducing interferon-β (TRIF) deficiency promotes retinal ganglion cell survival and axon regeneration via nuclear factor-κB

Gene Ref. Sequences Accession Forward (5'-3') Reverse (5'-3')
β-actin NM_007393.3 AGATTACTGCTCTGGCTCCTAGC ACTCATCGTACTCCTGCTTGCT
IL-1β NM_008361.3 TCCAGGATGAGGACAT GAACGTCACACACCAGCAGGTTA
IL-6 NM_031168.1 GAGGATACCACTCCCAACAGACC AAGTGCATCATCGTTGTTCATACA
IL-17 NM_010552.3 ACGCGCAAACATGAGTCCAG AGGCTCAGCAGCAGCAACAG
iNOS NM_010927.3 AATTCGGCTGTGCTTTGATGG GACTTGCGGGAGTCAGAATAGGAG
IFN-β NM_010510.1 AAGCAGCTCCAGCTCCAAGAA TTGAAGTCCGCCCTGTAGGTG
TNF-α NM_013693.2 TCCAGGCGGTGCCTATGT CGATCACCCCGAAGTTCAGTA
  1. IFN, interferon; IL, interleukin; iNOS, inducible NO synthase; TNF, tumor necrosis factor.