Skip to main content

Table 1 Primers used for quantitative PCR

From: The NALP3 inflammasome is involved in neurotoxic prion peptide-induced microglial activation

Name Sequence (5′→3′)
NALP3 ATTACCCGCCCGAGAAAGG
  TCGCAGCAAAGATCCACACAG
ASC GCAACTGCGAGAAGGCTAT
  CTGGTCCACAAAGTGTCCTG
β-actin GCTTCTTTGCAGCTCCTTCG
  CCTTCTGACCCATTCCCACC
CCL3 TCCCAGCCAGGTGTCATTT
  GGCATTCAGTTCCAGGTCAG
TNF CCCTTCCTCCGATGGCTAC
  CGCCTCCTTCTTGTTCTGG