Skip to main content

Table 1 Primer sequences for microglia and astrocyte cell markers and M1 or M2 activation markers

From: Preventive immunization of aged and juvenile non-human primates to beta-amyloid

Gene NCBI reference sequence Forward primer Reverse primer
Iba-1 NM_001047118.1 ccagggatttacagggagga atcgccgtttccattaaggt
CD68 XM_001110126 cagcacagtggacattctcg tgatgagaggcagcaagatg
GFAP XM_001102095.2 aagctccaggatgaaaccaa aacctcctcctcgtggatct
CXCL9 NM_001032936.1 taatgaggaagggtcgctgt tttggctgacctgtttttcc
CXCL10 NM_001032892.1 ttgctgccttgtctttctga tgatggccttagattctgga
IDO NM_001077483.1 ccgtcaagtgtttcagcaaa caggacgtcaaagcactgaa
CCR7 NM_001032884 gtggtggctctccttgtcat gtaggcccacgaaacaaatg
PTGS2 XM_001107538.2 cccttgggtgtgaaaggtaa gccctcgcttatgatctgtc
MRC1 NM_001193925 aaggaaaccatggacaatgc ccatccatccaagcaaactt
CCL17 NM_001032852.1 cttctctgcagcacatccat aacagatggccttgttctgg
GAPDH NM_001195426 tggaaggactcatgaccaca ttcagctcagggatgacctt