Journal of Neuroinflammation

Table 1 Sequence of specific primers used for quantitative real-time reverse transcription PCR

From: Expression of 2′,3′-cyclic nucleotide 3′-phosphodiesterase (CNPase) and its roles in activated microglia in vivo and in vitro

Gene Sequence
CNPase	Forward	gcaggaggtggtgaagagat
CNPase	Reverse	cagatggcttgtccagatca
TNF-α	Forward	cgtcagccgatttgctatct
TNF-α	Reverse	cggactccgcaaagtctaag
IL-1β	Forward	gcccatcctctgtgactcat
IL-1β	Reverse	aggccacaggtattttgtcg
iNOS	Forward	gcttgtctctgggtcctctg
iNOS	Reverse	ctcactgggacagcacagaa
β-actin	Forward	ggattccatacccaagaagga
β-actin	Reverse	gaagagctatgagctgcctga

CNPase, 2′,3′-cyclic nucleotide 3′-phosphodiesterase; IL-1β: interleukin-1beta; iNOS, inducible nitric oxide synthase; PCR, polymerase chain reaction; TNF-α, tumor necrosis factor alpha.

Back to article page

ISSN: 1742-2094

Contact us

Submission enquiries: journalsubmissions@springernature.com