Skip to main content

Advertisement

Table 1 Quantitative PCR primer sequences

From: Tumor necrosis factor alpha has an early protective effect on retinal ganglion cells after optic nerve crush

Gene name Primer sequence 5’→3’ Size (bp)
Aif1 Forward: AGAGAGGTGTCCAGTGGC 200
Reverse: CCCCACCGTGTGACCTCC
Gfap Forward: CAAACTGGCTGATGTCTACC 269
Reverse: AGAACTGGATCTCCTCATCC
Nrn1 Forward: TTCACTGATCCTCGCGGTGC 238
Reverse: TACTTTCGCCCCTTCCTGGC
Sncg Forward: GACCAAGCAGGGAGTAACGG 240
Reverse: TCCAAGTCCTCCTTGCGCAC
Tnfα Forward: CGCGACGTGGAACTGGCAGAA 276
Reverse: GTGGTTTGCTACGACGTGGGCT
S16 Forward: CACTGCAAACGGGGAAATGG 198
Reverse: TGAGATGGACTGTCGGATGG