Skip to main content

Table 1 RT-PCR assay characteristics and primer sequences

From: Anti-inflammatory T-cell shift in neuropathic pain

Gene Primer sequence
SDHA Roche RealTime Ready Single Assay ID 102136
TBP Roche RealTime Ready Single Assay ID 101145
FoxP3 Roche RealTime Ready Single Assay ID 113503
TGF-β for 5′ACTACTACGCCAAGGAGGTCAC 3′
  rev 5′TGCTTGAACTTGTCATAGATTTCG 3′, UPL probe #31
RORγT for 5′CAGCGCTCCAACATCTTCT 3′
  rev 5′CCACATCTCCCACATGGAC 3′, UPL probe #69