Skip to main content

Table 1 The primer sequences of β-actin, GPR109A, iNOS, COX-2, TNF-α, IL-1β, and IL-6

From: Anti-inflammatory effects of BHBA in both in vivo and in vitro Parkinson’s disease models are mediated by GPR109A-dependent mechanisms

Gene Sequences Length (bp)
β-actin (F) 5′- GTCAGGTCATCACTATCGGCAAT -3′ 147
(R) 5′- AGAGGTCTTTACGGATGTCAACGT -3′
GPR109A (F) 5′- GCTGCCCTGTCGGTTCAT -3′ 134
(R) 5′- CGTGGCTGACTTTCTCCTGAT -3′
iNOS (F) 5′- CACCCAGAAGAGTTACAGC -3′ 186
(R) 5′- GGAGGGAAGGGAGAATAG -3′
COX-2 (F) 5′- AGAGTCAGTTAGTGGGTAGT -3′ 170
(R) 5′- CTTGTAGTAGGCTTAAACATAG -3′
TNF-α (F) 5′- CCACGCTCTTCTGTCTACTG -3′ 145
(R) 5′- GCTACGGGCTTGTCACTC -3′
IL-1β (F) 5′- TGTGATGTTCCCATTAGAC -3′ 131
(R) 5′- AATACCACTTGTTGGCTTA -3′
IL-6 (F) 5′- AGCCACTGCCTTCCCTAC -3′ 156
(R) 5′- TTGCCATTGCACAACTCTT -3′