Skip to main content

Table 1 Rat primers used for real-time RT-PCR

From: Toll-like receptor 4 inhibition within the paraventricular nucleus attenuates blood pressure and inflammatory response in a genetic model of hypertension

Gene Sense Antisense
GAPDH Agacagccgcatcttcttgt cttgccgtgggtagagtcat
TNF-α gtcgtagcaaaccaccaagc tgtgggtgaggagcacatag
IL-1β gcaatggtcgggacatagtt agacctgacttggcagaga
IL-10 gggaagcaactgaaacttcg atcatggaaggagcaacctg
iNOS ccttgttcagctacgccttc ggtatgcccgagttctttca
TLR4 ggctgtggagacaaaaatgacctc aggcttgggcttgaatggagtc
  1. IL, Interleukin; TNF-α, Tumor necrosis factor-alpha; iNOS, Inducible nitric oxide synthase; GAPDH, Glyceraldehyde 3-phosphate dehydrogenase; TLR4, Toll-like receptor 4.