Skip to main content

Table 3 Primer sequences for qPCR analysis

From: Anti-inflammatory activity of Wnt signaling in enteric nervous system: in vitro preliminary evidences in rat primary cultures

Gene Abbreviations Primer sequences Accession
Toll-like receptor 4 TLR4 F: ATTGCTCAGACATGGCAGTTTC NM_019178.1
R: CACTCGAGGTAGGTGTTTCTGCTAA
Wingless type MMTV integration site family, member 3A WNT3A F: TGCAAATGCCACGGACTATC NM_001107005.2
R: AGACTCTCGGTGTTTCTCTACC
Frizzled 9 FZD9 F: TACCCAGAGCGCCCTATAAT NM_153305.1
R: CAAACCCTCCTGGATCACATAC
Axis inhibition protein 2 AXIN2 F: ACCTATGCCTGTCTCCTCTAAC NM_024355.1
R: GTCCAGGGTATCCACACATTTC
Myelocytomatosis proto-oncogene CMYC F: CTTGGAACGTCAGAGGAGAAA NM_012603.2
R: GCTTGAACGGACAGGATGTA
Jun proto-oncogene CJUN F: GAAGCAGAGCATGACCTTGA NM_021835.3
R: CCATTGCTGGACTGGATGAT
Interleukin-1β IL1B F: AGTGAGGAGAATGACCTGTTC NM_031512.2
R: CGAGATGCTGCTGTGAGATT
Interleukin-6 IL6 F: GCCAGAGTCATTCAGAGCAATA NM_26744.1
R: GTTGGATGGTCTTGGTCCTTAG
Interleukin-10 IL10 F: ATTGAACCACCCGGCATCTA NM_012854
R: CAACGAGGTTTTCCAAGGAG
Tumor necrosis factor α TNFa F: GCAGATGGGCTGTACCTTATC NM_012675.3
R: GGCTGACTTTCTCCTGGTATG
Hypoxanthine-guanine phosphoribosyltransferase HPRT F: GCTGACCTGCTGGATTACAT NM_012583.2
R: CCCGTTGACTGGTCATTACA
  1. F forward, R reverse.