Skip to main content

Advertisement

Table 1 Primer sequences for gene expression analyses

From: Insulin improves memory and reduces chronic neuroinflammation in the hippocampus of young but not aged brains

Gene Accession number Primer sequences F: forward; R: reverse Annealing temp (°C) Product length
IL1ß NM_031512 F: ACCTGCTAGTGTGTGATGTTCCCA 59.9 109
R: AGGTGGAGAGCTTTCAGCTCACAT 59.9
TNFα X66539.1 F: CTGGCCAATGGCATGGATCTCAAA 60 97
R: AGCCTTGTCCCTTGAAGAGAACCT 60
GADPH NM_017008 F: TGACTCTACCCACGGCAAGTTCAA 59.9 141
R: ACGACATACTCAGCACCAGCATCA 60
CREB1 NM_134443 F: TGTTCAAGCTGCCTCTGGTGATGTA 60 141
R: ACCTCTCTCTTTCGTGCTGCTTCTT 60
BDNF BC087634 F: AGCCTGTGTACTTTGTGTCCGAGA 60.3 123
R: TGGACGTTTGCTTCTTTCATGGGC 60.3
IR NM_017071 F: AGACCTTCGAGGATTACCTGCACAAC 60.3 118
R: TTGCCCACCTCTTCAAGGGATCTT 60.4
PRKCζ NM_022507 F:AGAGGGATCATCTACCGGGACCTAA 60.2 85
R:ACCTCTCTCTTTCGTGCTGCTTCTT 60.1
NGF β NM_001277055 F: ACTTCCAGGCCCATGGTACAATCT 60.2 145
R: ATGTCCGTGGCTGTGGTCTTATCT 60
CAMKIIα NM_012920 F: ACCAACACCACCATCGAGGATGAA 60.4 135
R: TGTCATTCCAGGGTCGCACATCTT 60.6
PSD95 NM_019621 F:AGCGACGAGAGTGGTCAAGGTTAAAG 60 139
R:CCAAGGATGATGATGGGACGAGCATA 60
SYN1 NM_019133 F: TCTCCAGCACACCTTGCTCCTAATC 60 128
R:CTGGTTGGTGGATAGTAGGTGGCATTT 60
  1. BDNF, brain-derived neurotrophic factor; CaMKIIα, Ca2+/calmodulin-dependent protein kinase II-alpha; CREB1, cAMP response element-binding protein-1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IL, interleukin; iNOS, inducible nitric oxide synthase; IR, insulin receptor; NGF β, nerve growth factor-beta; PRKCζ, protein kinase C-zeta; PSD95, postsynaptic density protein 95; SYN1, Synapsin I; TNF-α, tumor necrosis factor-alpha.