Skip to main content

Advertisement

Table 1 Primers and probes for the mouse chemokines CXCL1, CXCL10 (IP-10) and for the acute phase protein SAA-1

From: The role of PPAR activation during the systemic response to brain injury

Marker and probe Forward primer Reverse primer
CXCL1 (probe #83) AGCCACACTCCAACACAGC CAGCGCTGCACAGAGAAG
SAA-1 (probe #32) CCAGGATGAAGCTACTCACCA TAGGCTCGCCACATGTCC
CXCL10 (probe #3) GCTGCCGTCATTTTCTGC TCTCACTGGCCCGTCATC