Skip to main content

Advertisement

Table 1 List of primers used for SYBR Green quantitative PCR

From: Absence of toll-like receptor 4 (TLR4) extends survival in the hSOD1G93A mouse model of amyotrophic lateral sclerosis

Gene of interest Primer sequence Product length
TLR4 Forward: 5′ - ATGCATGGATCAGAAACTCAGCAA - 3′ 249
Reverse: 5′ - AAACTTCCTGGGGAAAAACTCTGG - 3′
HMGB1 Forward: 5′ - GCTCTCACAGCCATTGCAGTACAT - 3′ 129
Reverse: 5′ - AGGATCTCCTTTGCCCATGTTTAG - 3′
GAPDH Forward: 5′ - AGGTCGGTGTGAACGGATTTG - 3′ 123
Reverse: 5′ - TGTAGACCATGTAGTTGAGGTC - 3′
  1. TLR4, toll-like receptor 4; HMGB1, high-mobility group box 1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.