Skip to main content

Advertisement

Table 1 Primer sequences for genotyping

From: TANK-binding kinase 1 (TBK1) modulates inflammatory hyperalgesia by regulating MAP kinases and NF-κB dependent genes

  Primers
TBK1 wild 5′- CTAATGGTTGTAGTCAGGGTCTCCTGC -3′
TBK1 extra 5′- TGCGTTCCTGTCCTGACCGTGATTGTG -3′
TBK1 neo 5′- ATCGCCTTCTATCGCCTTCTTGACGAG -3′
TNFRSense1 5′- AGATGGAGAAGGGCAGTTAG -3′
AntiS1 5′- ATACCAGGGTTTGAGCTCAG -3′
AntiS2 5′- TACTTTGTTAAGAAGGGTGAGA -3′