Skip to main content

Table 1 Primers used in RT-PCR reactions

From: β-Lapachone suppresses neuroinflammation by modulating the expression of cytokines and matrix metalloproteinases in activated microglia

Species Gene Forward primer (5′ → 3′) Reverse primer (5′ → 3′) Size (bp)
Mouse TNF-α CCTATGTCTCAGCCTCTTCT CCTGGTATGAGATAGCAAAT 354
iNOS CAAGAGTTTGACCAGAGGACC TGGAACCACTCGTACTTGGGA 450
IL-1β GGCAACTGTTCCTGAACTCAACTG CCATTGAGGTGGAGAGCTTTCAGC 447
IL-6 CCACTTCACAAGTCGGAGGCTT CCAGCTTATCTGTTAGGAGA 395
IL-10 GCCAGTACAGCCGGGAAGACAATA GCCTTGTAGACACCTTGGTCTT 409
MMP-3 ATTCAGTCCCTCTATGGA CTCCAGTATTTGTCCTCTAC 375
MMP-8 CCAAGGAGTGTCCAAGCCAT CCTGCAGGAAAACTGCATCG 180
MMP-9 GTGATCCCCACTTACTATGGAAAC GAAGCCATACAGTTTATCCTGGTC 352
TIMP-2 TCTAATTGCAGGAAAGGCAGA TGCTCTTCTCTGTGACCCAGT 218
HO-1 TGTCACCCTGTGCTTGACCT ATACCCGCTACCTGGGTGAC 209
NQO1 AGAGGCTCTGAAGAAGAGAGG CACCCTGAAGAGAGTACATGG 401
p47phox CGATGGATTGTCCTTTGTGC ATCACCGGCTATTTCCCATC 256
p67phox CTTCAACATAGGCTGCGTGA CTTCATGTTGGTTGCCAATG 334
p22phox AAAGAGGAAAAAGGGGTCCA TAGGCTCAATGGGAGTCCAC 239
gp91phox GTCAAGTGCCCCAAGGTATCCA TTGTAGCTGAGGAAGTTGGC 453
GAPDH ATGTACGTAGCCATCCAGGC AGGAAGGAAGGCTGGAAGAG 420
Rat TNF-α AAGTTCCCAAATGGGCTCCCT TGAAGTGGCAAATCGGCTGAC 306
iNOS GCAGAATGTGACCATCATGG ACAACCTTGGTGTTGAAGGC 426
IL-1β AAATGCCTCGTGCTGTCTGACC TCCCGACCATTGCTGTTTCCT 377
IL-6 TCATTCTGTCTCGAGCCCAC GAAGTAGGGAAGGCAGTGGC 345
IL-10 AGGGCTGCCTTCAGTCAAGT AGAAATCGATGACAGCGTCG 396
MMP-3 GTACCAACCTATTCCTGGTTGC CCAGAGAGTTAGATTTGGTGGG 231
MMP-8 TACAACCTGTTTCTCGTGGCTGC TCAACTGTTCTCAGCTGGGGATG 317
MMP-9 AAGTTGAACTCAGCCTTTGAGG GTCGAATTTCCAGATACGTTCC 225
TIMP-2 CGTAGTGATCAGAGCCAAGC TCTGCCTTTCCTGCAATTAGA 225
GAPDH GTGCTGAGTATGTCGTGGAGTCT ACAGTCTTCTGAGTGGCAGTGA 292