Skip to main content

Table 1 Gene primer sequences for RT-PCR analysis

From: Apocynin prevents mitochondrial burdens, microglial activation, and pro-apoptosis induced by a toxic dose of methamphetamine in the striatum of mice via inhibition of p47phox activation by ERK

Gene Forward primer (5′-3′) Reverse primer (5′-3′)
Arginase 1 GAACACGGCAGTGGCTTTAAC TGCTTAGCTCTGTCTGCTTTGC
CD206 TCTTTGCCTTTCCCAGTCTCC TGACACCCAGCGGAATTTC
CD16 TTTGGACACCCAGATGTTTCAG GTCTTCCTTGAGCACCTGGATC
CD32 AATCCTGCCGTTCCTACTGATC GTGTCACCGTGTCTTCCTTGAG
CD86 TTGTGTGTGTTCTGGAAACGGAG AACTTAGAGGCTGTGTTGCTGGG
GAPDH ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA