Skip to main content

Table 1 Sequences of primers used for amplification of target cDNA of interleukin 6 (IL-6), tyrosine hydroxylase (TH), tumor necrosis factor alpha (TNF-α), inducible nitric oxide synthases 2 (iNOS2), interleukin 10 (IL-10), transforming growth factor beta 1 (TGFβ1), and 18S ribosomal protein

From: Tauopathy in transgenic (SHR72) rats impairs function of central noradrenergic system and promotes neuroinflammation

Gene Primer Oligonucleotide sequence
IL-6 Forward AAGTCGGAGGCTTAATTACATATGTTC
Reverse TCATCGCTGTTCATACAATCAGAA
TH Forward TCTCCCTGAGGGGTACAAAA
Reverse GAATTTTGGCTTCAAATGTCTCA
TNF-α Forward TGATCGGTCCCAACAAGGA
Reverse TGGGCTACGGGCTTGTCA
iNOS2 Forward GCTTCAGAATGGGGAGCTG
Reverse AGGTTGGAGGCCTTGTGTC
IL-10 Forward CCCTGGGAGAGAAGCTGAAGA
Reverse CACTGCCTTGCTTTTATTCTCACA
TGFβ1 Forward CCTGGAAAGGGCTCAACAC
Reverse CAGTTCTTCTCTGTGGAGCTGA
18S Forward ATGGTTCCTTTGTCGCTCGCTCC
Reverse TGGATGTGGTAGCCGTTTCTCAGG