Skip to main content

Table 1 Specific primers used for quantitative real-time RT-PCR (qPCR)

From: Lipoxin A4 inhibits microglial activation and reduces neuroinflammation and neuropathic pain after spinal cord hemisection

  Forward primers Reverse primers Accession no.
GAPDH TTGATGGCAACAATCTCCAC CGTCCCGTAGACAAAATGGT NM_001001303
FPR2 CACAGGAACCGAAGAGTGTAAG CACCATTGAGAGGATCCACAG NM_008039
GFAP GAATCGCTGGAGGAGGAGAT GCCACTGCCTCGTATTGAGT NM_010277
IBA1 GGACAGACTGCCAGCCTAAG GACGGCAGATCCTCATCATT NM_019467
P2RY12 TTTCAGATCCGCAGTAAATCCAA GGCTCCCAGTTTAGCATCACTA NM_016928
TNF-α CCCCAAAGGGATGAGAAGTT CACTTGGTGGTTTGCTACGA NM_013693
IL-6 TCCATCCAGTTGCCTTCTTGG CCACGATTTCCCAGAGAACATG NM_031168
iNOS GGAGTGACGGCAAACATGACT TAGCCAGCGTACCGGATGA NM_010927
TGFβ CCACCTGCAAGACCATCGAC CTGGCGAGCCTTAGTTTGGAC NM_011577
IL-10 AGCCGGGAAGACAATAACTG GGAGTCGGTTAGCAGTATGTTG NM_010548